ID: 1102941958_1102941963

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1102941958 1102941963
Species Human (GRCh38) Human (GRCh38)
Location 12:116950856-116950878 12:116950895-116950917
Sequence CCCACGGATGCTACAGTTTGGTG CTTAGATCATTCCAGCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 668} {0: 1, 1: 0, 2: 1, 3: 10, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!