ID: 1102943271_1102943274

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1102943271 1102943274
Species Human (GRCh38) Human (GRCh38)
Location 12:116962482-116962504 12:116962500-116962522
Sequence CCCTGGGGGGGCACCACTGAAAA GAAAACAGTGTGCAGACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96} {0: 1, 1: 0, 2: 0, 3: 10, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!