ID: 1102951415_1102951421

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1102951415 1102951421
Species Human (GRCh38) Human (GRCh38)
Location 12:117033925-117033947 12:117033938-117033960
Sequence CCGCAGCCTCGTTAACTGCAGGC AACTGCAGGCAGGTGGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 459} {0: 1, 1: 0, 2: 4, 3: 41, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!