ID: 1102952966_1102952975

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1102952966 1102952975
Species Human (GRCh38) Human (GRCh38)
Location 12:117042294-117042316 12:117042313-117042335
Sequence CCCCCAGGGAGAATCCGAGGTGT GTGTGGGTGACATGAGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86} {0: 1, 1: 0, 2: 1, 3: 39, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!