ID: 1102955239_1102955253

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1102955239 1102955253
Species Human (GRCh38) Human (GRCh38)
Location 12:117054636-117054658 12:117054673-117054695
Sequence CCCGTGAGCAGCACCCCAGTTTC GAGGCTCAGCACCTTGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145} {0: 1, 1: 1, 2: 9, 3: 145, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!