ID: 1102971111_1102971117

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1102971111 1102971117
Species Human (GRCh38) Human (GRCh38)
Location 12:117167573-117167595 12:117167613-117167635
Sequence CCCGGTCTCTACAAAAAAATTGG CACCTGTAGTCCCAGCTACTCGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 176, 3: 1988, 4: 9838} {0: 27099, 1: 99923, 2: 128146, 3: 148395, 4: 176885}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!