|
Left Crispr |
Right Crispr |
| Crispr ID |
1102971111 |
1102971118 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:117167573-117167595
|
12:117167614-117167636
|
| Sequence |
CCCGGTCTCTACAAAAAAATTGG |
ACCTGTAGTCCCAGCTACTCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 176, 3: 1988, 4: 9838} |
{0: 27977, 1: 146191, 2: 244935, 3: 217028, 4: 128877} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|