ID: 1102975925_1102975931

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1102975925 1102975931
Species Human (GRCh38) Human (GRCh38)
Location 12:117207284-117207306 12:117207299-117207321
Sequence CCCTGGCTATGGATGCAGCTGTG CAGCTGTGCTGGAGGAAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 254} {0: 1, 1: 0, 2: 5, 3: 49, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!