ID: 1102981993_1102981998

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1102981993 1102981998
Species Human (GRCh38) Human (GRCh38)
Location 12:117249237-117249259 12:117249263-117249285
Sequence CCCAAGCTCATCTGTGGAAGGGC TGAAACCTAAGGGCTCTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 143} {0: 1, 1: 0, 2: 1, 3: 2, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!