ID: 1102998427_1102998434

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1102998427 1102998434
Species Human (GRCh38) Human (GRCh38)
Location 12:117366905-117366927 12:117366953-117366975
Sequence CCTGCTTTCCAGACCTGGCACTT GGAAACTCCTTGGCATCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 193} {0: 1, 1: 0, 2: 1, 3: 18, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!