ID: 1103031628_1103031631

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1103031628 1103031631
Species Human (GRCh38) Human (GRCh38)
Location 12:117619056-117619078 12:117619069-117619091
Sequence CCAAAGATAACTCCCACCTTCAA CCACCTTCAAGAAACCTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180} {0: 1, 1: 0, 2: 3, 3: 31, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!