ID: 1103032945_1103032951

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103032945 1103032951
Species Human (GRCh38) Human (GRCh38)
Location 12:117632520-117632542 12:117632541-117632563
Sequence CCTGCCACCTACTCCTTTTTCTA TAGCTTTGATTTCAGGTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 543} {0: 1, 1: 2, 2: 34, 3: 747, 4: 2609}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!