ID: 1103036636_1103036640

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1103036636 1103036640
Species Human (GRCh38) Human (GRCh38)
Location 12:117662259-117662281 12:117662285-117662307
Sequence CCAGCAAACTTCTGTCAAGACAC CCTCTCCTCCCTCTCTTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 197} {0: 1, 1: 1, 2: 6, 3: 78, 4: 641}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!