ID: 1103038427_1103038432

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1103038427 1103038432
Species Human (GRCh38) Human (GRCh38)
Location 12:117675142-117675164 12:117675179-117675201
Sequence CCCAGCTGGAATTCTGCATTTAC GAGGAATGTCTGTCTCCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 238} {0: 1, 1: 0, 2: 2, 3: 7, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!