ID: 1103061637_1103061647

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1103061637 1103061647
Species Human (GRCh38) Human (GRCh38)
Location 12:117863139-117863161 12:117863180-117863202
Sequence CCATCACAGCTGCAGGATGCGCA AAACAGCTGTACTTGGGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 134} {0: 1, 1: 0, 2: 1, 3: 28, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!