ID: 1103070303_1103070311

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1103070303 1103070311
Species Human (GRCh38) Human (GRCh38)
Location 12:117935799-117935821 12:117935836-117935858
Sequence CCCACTCCACTCTGGTCACACAA CCTCAGACACCTCAGGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178} {0: 1, 1: 0, 2: 9, 3: 244, 4: 8454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!