ID: 1103096385_1103096392

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1103096385 1103096392
Species Human (GRCh38) Human (GRCh38)
Location 12:118136162-118136184 12:118136194-118136216
Sequence CCTGGCCTACCGCGGCACTCCCG TCTGCTTGGCCTCGCCATGCCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 3, 4: 90} {0: 1, 1: 1, 2: 0, 3: 21, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!