|
Left Crispr |
Right Crispr |
Crispr ID |
1103115951 |
1103115959 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:118332055-118332077
|
12:118332081-118332103
|
Sequence |
CCTCAGGTGATCCTTCCACCTTG |
TCCCACAGTGCTGGGATTACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 15, 1: 726, 2: 10262, 3: 35679, 4: 73816} |
{0: 2641, 1: 295980, 2: 261775, 3: 149501, 4: 132181} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|