ID: 1103122145_1103122154

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1103122145 1103122154
Species Human (GRCh38) Human (GRCh38)
Location 12:118389239-118389261 12:118389262-118389284
Sequence CCTACCCTGCCCCAGCCCGTGGG AGAATTGTCTTCCACCGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 659} {0: 1, 1: 2, 2: 19, 3: 496, 4: 1125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!