ID: 1103147546_1103147553

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1103147546 1103147553
Species Human (GRCh38) Human (GRCh38)
Location 12:118608800-118608822 12:118608831-118608853
Sequence CCAGCTCTAGTGACTAGAGGCAA GAGAGCTGGAAGAGGAAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 122, 4: 1080}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!