ID: 1103168221_1103168226

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1103168221 1103168226
Species Human (GRCh38) Human (GRCh38)
Location 12:118789290-118789312 12:118789333-118789355
Sequence CCATCACCCACTGCTGTTTCCTG TGATCTTACATCCTTGCCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!