ID: 1103176096_1103176103

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1103176096 1103176103
Species Human (GRCh38) Human (GRCh38)
Location 12:118864806-118864828 12:118864833-118864855
Sequence CCCTAGAGTTGACCCATCTGTAA GGGCTGATGAGACCAATATCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!