ID: 1103183529_1103183540

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1103183529 1103183540
Species Human (GRCh38) Human (GRCh38)
Location 12:118936091-118936113 12:118936123-118936145
Sequence CCTCCTCGCTCCTTCCCCACCTT GTGCCAGATTATAGTTGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 114, 4: 1239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!