ID: 1103183531_1103183539

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1103183531 1103183539
Species Human (GRCh38) Human (GRCh38)
Location 12:118936094-118936116 12:118936122-118936144
Sequence CCTCGCTCCTTCCCCACCTTGGC TGTGCCAGATTATAGTTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 458} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!