ID: 1103214987_1103214994

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1103214987 1103214994
Species Human (GRCh38) Human (GRCh38)
Location 12:119195106-119195128 12:119195143-119195165
Sequence CCAACCAGGTGGCACAGACAACC ACTGTATCTGGATGGGCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 3, 3: 18, 4: 269} {0: 1, 1: 1, 2: 2, 3: 16, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!