ID: 1103235803_1103235810

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1103235803 1103235810
Species Human (GRCh38) Human (GRCh38)
Location 12:119371550-119371572 12:119371598-119371620
Sequence CCGCTTAAAAGCCATCAAATCTT CCTGAGGTTTTCCCATTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 103, 4: 880} {0: 1, 1: 0, 2: 1, 3: 13, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!