ID: 1103250511_1103250514

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1103250511 1103250514
Species Human (GRCh38) Human (GRCh38)
Location 12:119496027-119496049 12:119496041-119496063
Sequence CCACTGTGGTACTCCAGTGGACA CAGTGGACATCTCTGTGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 122} {0: 1, 1: 0, 2: 4, 3: 37, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!