ID: 1103261457_1103261464

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1103261457 1103261464
Species Human (GRCh38) Human (GRCh38)
Location 12:119593009-119593031 12:119593034-119593056
Sequence CCTAGGCCAGCCTGATCTACCTG TTTCTCCCCAGGGGTCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 622} {0: 1, 1: 0, 2: 4, 3: 30, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!