ID: 1103316797_1103316808

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1103316797 1103316808
Species Human (GRCh38) Human (GRCh38)
Location 12:120062711-120062733 12:120062764-120062786
Sequence CCTTCCCCCTTTCCCTTGGAATG GTAAGTAGAGTTTGTTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 341} {0: 1, 1: 0, 2: 2, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!