ID: 1103318275_1103318286

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1103318275 1103318286
Species Human (GRCh38) Human (GRCh38)
Location 12:120074492-120074514 12:120074528-120074550
Sequence CCAGTGAGGACTCGAGAGCCCTA AGGGAGAGAGGGGTAAACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64} {0: 1, 1: 0, 2: 6, 3: 83, 4: 674}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!