ID: 1103320008_1103320019

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1103320008 1103320019
Species Human (GRCh38) Human (GRCh38)
Location 12:120086981-120087003 12:120087022-120087044
Sequence CCGCGGCTGTAGCCCTGGGCCCA CGTTAGTCAGCACATTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 251} {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!