ID: 1103321398_1103321412

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1103321398 1103321412
Species Human (GRCh38) Human (GRCh38)
Location 12:120094673-120094695 12:120094710-120094732
Sequence CCCCTGCCCCTCCCGCCTGGCAC GCTGCAGCGTGCCATCCGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 751} {0: 1, 1: 0, 2: 0, 3: 2, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!