ID: 1103321403_1103321413

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1103321403 1103321413
Species Human (GRCh38) Human (GRCh38)
Location 12:120094681-120094703 12:120094714-120094736
Sequence CCTCCCGCCTGGCACTGCCCCCT CAGCGTGCCATCCGCAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 38, 4: 585} {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!