ID: 1103322090_1103322097

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1103322090 1103322097
Species Human (GRCh38) Human (GRCh38)
Location 12:120098169-120098191 12:120098218-120098240
Sequence CCGGCGCGCCCGGCCCAGCTGGA CCCCTGCTGTTCACGGACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 134, 4: 1053} {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!