ID: 1103323549_1103323558

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1103323549 1103323558
Species Human (GRCh38) Human (GRCh38)
Location 12:120105356-120105378 12:120105402-120105424
Sequence CCCAGAAACAGCTGGTGGCTAAC AAGAATGACCAGGGGGTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 101} {0: 1, 1: 0, 2: 2, 3: 15, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!