ID: 1103326462_1103326469

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1103326462 1103326469
Species Human (GRCh38) Human (GRCh38)
Location 12:120124617-120124639 12:120124658-120124680
Sequence CCAAAACTGTCAAATCTGCAGCC GTCCTCCCGCATCACAGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155} {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!