ID: 1103333120_1103333127

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1103333120 1103333127
Species Human (GRCh38) Human (GRCh38)
Location 12:120168597-120168619 12:120168615-120168637
Sequence CCCTGCCCTTCCCTGACTGGGGC GGGGCTGTTTGGACTCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 531} {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!