ID: 1103338091_1103338096

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1103338091 1103338096
Species Human (GRCh38) Human (GRCh38)
Location 12:120205017-120205039 12:120205059-120205081
Sequence CCAAACTATAGCTCATGGGCCAA CTGTAGATAAAGTTGTGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 16, 4: 108} {0: 1, 1: 0, 2: 2, 3: 11, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!