ID: 1103350137_1103350152

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1103350137 1103350152
Species Human (GRCh38) Human (GRCh38)
Location 12:120278256-120278278 12:120278295-120278317
Sequence CCCACCTCCCAGACGGGGGAGCC CACCTCCCAGACGGGGTGGCTGG
Strand - +
Off-target summary No data {0: 101, 1: 1063, 2: 3749, 3: 4729, 4: 9277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!