ID: 1103350137_1103350153

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1103350137 1103350153
Species Human (GRCh38) Human (GRCh38)
Location 12:120278256-120278278 12:120278296-120278318
Sequence CCCACCTCCCAGACGGGGGAGCC ACCTCCCAGACGGGGTGGCTGGG
Strand - +
Off-target summary No data {0: 18, 1: 115, 2: 644, 3: 1822, 4: 3359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!