ID: 1103350142_1103350150

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1103350142 1103350150
Species Human (GRCh38) Human (GRCh38)
Location 12:120278263-120278285 12:120278291-120278313
Sequence CCCAGACGGGGGAGCCGGGCAGA CCCTCACCTCCCAGACGGGGTGG
Strand - +
Off-target summary No data {0: 470, 1: 2780, 2: 5106, 3: 6555, 4: 7937}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!