ID: 1103361460_1103361464

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1103361460 1103361464
Species Human (GRCh38) Human (GRCh38)
Location 12:120356842-120356864 12:120356868-120356890
Sequence CCTGCTAGTCCTGGGAGCAGTTC CAGAAAGAAGCCGCAGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 99} {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!