ID: 1103372371_1103372377

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1103372371 1103372377
Species Human (GRCh38) Human (GRCh38)
Location 12:120429496-120429518 12:120429519-120429541
Sequence CCCTGCTCTCGTGAAGCTTTTCC CAGGCGACTTAGAAGTTAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!