ID: 1103380795_1103380802

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1103380795 1103380802
Species Human (GRCh38) Human (GRCh38)
Location 12:120492817-120492839 12:120492830-120492852
Sequence CCCCATATGGGCCACTTCAGGGG ACTTCAGGGGGACCTGGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 141} {0: 1, 1: 0, 2: 1, 3: 16, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!