ID: 1103407455_1103407466

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1103407455 1103407466
Species Human (GRCh38) Human (GRCh38)
Location 12:120686353-120686375 12:120686392-120686414
Sequence CCGCCGGCGGCGACTCCCGCCAG GTCCCGCCCCTACGCAGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112} {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!