|
Left Crispr |
Right Crispr |
| Crispr ID |
1103425352 |
1103425362 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:120829478-120829500
|
12:120829504-120829526
|
| Sequence |
CCCAGCTACTCTGGAGACTGAGG |
GGGAATCGCTTGGACCTAGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 337, 1: 16942, 2: 226070, 3: 279138, 4: 169904} |
{0: 1, 1: 44, 2: 2827, 3: 57304, 4: 165041} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|