ID: 1103430567_1103430572

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1103430567 1103430572
Species Human (GRCh38) Human (GRCh38)
Location 12:120881694-120881716 12:120881746-120881768
Sequence CCCATACAGTCAAGTATTATCCA CGCTAAATATAGATGAAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 161} {0: 1, 1: 0, 2: 2, 3: 19, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!