ID: 1103478183_1103478192

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1103478183 1103478192
Species Human (GRCh38) Human (GRCh38)
Location 12:121233558-121233580 12:121233586-121233608
Sequence CCACACCTGGGCTCTCCACAGCC AAAGAACAGAGAGGAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 495} {0: 1, 1: 0, 2: 45, 3: 498, 4: 3211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!