ID: 1103478185_1103478194

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1103478185 1103478194
Species Human (GRCh38) Human (GRCh38)
Location 12:121233573-121233595 12:121233595-121233617
Sequence CCACAGCCCCATCAAAGAACAGA AGAGGAGGAGGAGGGAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 303} {0: 1, 1: 12, 2: 219, 3: 1639, 4: 8255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!