ID: 1103480476_1103480479

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1103480476 1103480479
Species Human (GRCh38) Human (GRCh38)
Location 12:121247178-121247200 12:121247194-121247216
Sequence CCACTTCTTCCCAGTGGGTCCAA GGTCCAAGTGTGCCTCCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 227} {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!